pES.HSV2.3a
(Plasmid
#69593)
-
PurposeTCR a chain construct for generation of gBT-I mice
-
Depositing Lab
-
Depositing OrganizationMonash University
Located in Australia -
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69593 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 69593-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 69593-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepES4
-
Backbone manufacturerKaye, et al. J. Immunol. 1992; 148: 3342-53.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTCR alpha chain cDNA from clone HSV2.3
-
Alt nameT cell receptor alpha chain
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)800
-
Entrez GeneTcra (a.k.a. Tcralpha)
- Promoter H-2Kb
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BglII (destroyed during cloning)
- 5′ sequencing primer pES4-Fwd GGATCCAGGAATGGACAAGATTCTG
- 3′ sequencing primer pES4-Rev CAGATCTCAACTGGACCACAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
ClaI/NotI fragment used to make transgenic mice
DNA (Catalog # 69593-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 69593-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pES.HSV2.3a was a gift from Francis R. Carbone (Addgene plasmid # 69593 ; http://n2t.net/addgene:69593 ; RRID:Addgene_69593) -
For your References section:
Characterization of two TCR transgenic mouse lines specific for herpes simplex virus. Mueller SN, Heath W, McLain JD, Carbone FR, Jones CM. Immunol Cell Biol. 2002 Apr;80(2):156-63. 10.1046/j.1440-1711.2002.01071.x PubMed 11940116
Map uploaded by the depositor.