Skip to main content

p3A9cbetaTCR.HSV2.3
(Plasmid #69594)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69594 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 69594-D50 50 μg of DNA in Tris buffer $495
DNA 69594-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    p3A9CbetaTCR
  • Backbone manufacturer
    Carbone Lab, Addgene plasmid 69600
  • Total vector size (bp) 13590
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TCR beta VJ region from clone HSV2.3
  • Alt name
    T cell receptor beta chain
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1000
  • Entrez Gene
    Tcrb (a.k.a. TCRbeta, Tib)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer AATCGATGGCCACTGGTGTGCTT
  • 3′ sequencing primer ATCGATTCTTCCTCAAGGAGGAACCA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

ApaI/NotI removes transgenic construct

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p3A9cbetaTCR.HSV2.3 was a gift from Francis R. Carbone (Addgene plasmid # 69594 ; http://n2t.net/addgene:69594 ; RRID:Addgene_69594)
  • For your References section:

    Characterization of two TCR transgenic mouse lines specific for herpes simplex virus. Mueller SN, Heath W, McLain JD, Carbone FR, Jones CM. Immunol Cell Biol. 2002 Apr;80(2):156-63. 10.1046/j.1440-1711.2002.01071.x PubMed 11940116