Skip to main content

pX330-mitf
(Plasmid #69801)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69801 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 69801-D50 50 μg of DNA in Tris buffer $495
DNA 69801-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    px330 (Addgene 42230)
  • Backbone size w/o insert (bp) 8506
  • Total vector size (bp) 8526
  • Modifications to backbone
    The R1 sgRNA genome targeting sequence was cloned into the pX330 vector
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mitf-sgRNA
  • Species
    Porcine
  • Insert Size (bp)
    20
  • Promoter U6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer CAAGGCTGTTAGAGAGATAATTGGA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    SpCas9
  • Species
    Synthetic
  • Insert Size (bp)
    4101
  • Promoter Chicken Beta-Actin

Cloning Information for Gene/Insert 2

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

the pX330 vector, created by the laboratory of Dr. Feng Zhang and obtained from Addgene (Plasmid 42230), was used. The R1 sgRNA genome targeting sequence was cloned into the pX330 vector.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-mitf was a gift from Jianguo Zhao (Addgene plasmid # 69801 ; http://n2t.net/addgene:69801 ; RRID:Addgene_69801)
  • For your References section:

    Efficient CRISPR/Cas9-mediated biallelic gene disruption and site-specific knockin after rapid selection of highly active sgRNAs in pigs. Wang X, Zhou J, Cao C, Huang J, Hai T, Wang Y, Zheng Q, Zhang H, Qin G, Miao X, Wang H, Cao S, Zhou Q, Zhao J. Sci Rep. 2015 Aug 21;5:13348. doi: 10.1038/srep13348. 10.1038/srep13348 PubMed 26293209