pECE M2-SNX17 WT
(Plasmid
#69811)
-
PurposeExpresses M2-SNX17 in mammalian cells
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69811 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 69811-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 69811-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepECE
- Backbone size w/o insert (bp) 2898
- Total vector size (bp) 4344
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSorting nexin-17
-
Alt nameSNX17
-
SpeciesH. sapiens (human)
-
Entrez GeneSNX17
- Promoter SV40 early promoter
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site Xba1 (not destroyed)
- 5′ sequencing primer CATTCTCCGCCCCATGGCTGAC
- 3′ sequencing primer GTTTCAGGTTCAGGGGGAGGTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycDNA is from the Orfeome library (Open Biosystems)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 69811-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 69811-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pECE M2-SNX17 WT was a gift from Anne Brunet (Addgene plasmid # 69811 ; http://n2t.net/addgene:69811 ; RRID:Addgene_69811) -
For your References section:
Identification of AMPK Phosphorylation Sites Reveals a Network of Proteins Involved in Cell Invasion and Facilitates Large-Scale Substrate Prediction. Schaffer BE, Levin RS, Hertz NT, Maures TJ, Schoof ML, Hollstein PE, Benayoun BA, Banko MR, Shaw RJ, Shokat KM, Brunet A. Cell Metab. 2015 Nov 3;22(5):907-21. doi: 10.1016/j.cmet.2015.09.009. Epub 2015 Oct 8. 10.1016/j.cmet.2015.09.009 PubMed 26456332