Skip to main content

pECE M2-SH3PXD2A WT
(Plasmid #69813)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69813 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 69813-D50 50 μg of DNA in Tris buffer $495
DNA 69813-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pECE
  • Backbone size w/o insert (bp) 2898
  • Total vector size (bp) 6249
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SH3 and PX domain-containing protein 2A
  • Alt name
    SH3PXD2A, FISH, TKS5
  • Species
    H. sapiens (human)
  • Entrez Gene
    SH3PXD2A (a.k.a. FISH, SH3MD1, TKS5)
  • Promoter SV40 early promoter
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 in backbone, Mfe1 in TKS5 pcr product (destroyed during cloning)
  • 3′ cloning site Xba1 (not destroyed)
  • 5′ sequencing primer CATTCTCCGCCCCATGGCTGAC
  • 3′ sequencing primer GTTTCAGGTTCAGGGGGAGGTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    cDNA is from GeneCopoeia

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pECE M2-SH3PXD2A WT was a gift from Anne Brunet (Addgene plasmid # 69813 ; http://n2t.net/addgene:69813 ; RRID:Addgene_69813)
  • For your References section:

    Identification of AMPK Phosphorylation Sites Reveals a Network of Proteins Involved in Cell Invasion and Facilitates Large-Scale Substrate Prediction. Schaffer BE, Levin RS, Hertz NT, Maures TJ, Schoof ML, Hollstein PE, Benayoun BA, Banko MR, Shaw RJ, Shokat KM, Brunet A. Cell Metab. 2015 Nov 3;22(5):907-21. doi: 10.1016/j.cmet.2015.09.009. Epub 2015 Oct 8. 10.1016/j.cmet.2015.09.009 PubMed 26456332