pCB6-Cor1-HA
(Plasmid #102815)

• Purpose: Expression of Coronin1 in eukaryotic cells
• Depositing Lab: Jean Pieters
• Publication: Gatfield et al Mol Biol Cell. 2005 Jun;16(6):2786-98. Epub 2005 Mar 30.

Backbone

• Vector backbone: pCB6
• Backbone size w/o insert (bp): 6189
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TACO/Coronin 1
• Species: M. musculus (mouse)
• Entrez Gene: Coro1a (a.k.a. Clabp, Lmb3, TACO, p57)
• Promoter: CMV
• Tag / Fusion Protein:
  • HA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: CMV-F CGCAAATGGGCGGTAGGCGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The C-terminally hemagglutinin (HA)-tagged version of coronin 1 (Cor1-HA) was generated by PCR, by using as template the coronin 1 cDNA cloned into pBluescript via the EcoRI site (Veithen et al., 1996; Ferrari et al., 1999).

The forward primer was
5'-ACAAGCAGCGGAGTCCTGCTACC-3'
(coronin 1 nucleotides 796–818)

and the EcoRI site-containing reverse primer was
5'-CGCGAATTCCTATGCGTAGTCTGGTACGTCGTATGGGTACTTGGCCTGAACAGTCTC-3'
encoding the HA tag and the EcoRI site.

The product was digested with HindIII and EcoRI, and the HindIII/EcoRI fragment was used for exchanging the corresponding wild-type fragment in the pBluescript construct.

For expression in mammalian cells, the construct was cloned via the EcoRI site into the cytomegalovirus promoter-driven pCB6 expression vector.