pCB6-Cor1-HA
(Plasmid
#102815)
-
PurposeExpression of Coronin1 in eukaryotic cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102815 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCB6
- Backbone size w/o insert (bp) 6189
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTACO/Coronin 1
-
SpeciesM. musculus (mouse)
-
Entrez GeneCoro1a (a.k.a. Clabp, Lmb3, TACO, p57)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The C-terminally hemagglutinin (HA)-tagged version of coronin 1 (Cor1-HA) was generated by PCR, by using as template the coronin 1 cDNA cloned into pBluescript via the EcoRI site (Veithen et al., 1996; Ferrari et al., 1999).
The forward primer was
5'-ACAAGCAGCGGAGTCCTGCTACC-3'
(coronin 1 nucleotides 796–818)
and the EcoRI site-containing reverse primer was
5'-CGCGAATTCCTATGCGTAGTCTGGTACGTCGTATGGGTACTTGGCCTGAACAGTCTC-3'
encoding the HA tag and the EcoRI site.
The product was digested with HindIII and EcoRI, and the HindIII/EcoRI fragment was used for exchanging the corresponding wild-type fragment in the pBluescript construct.
For expression in mammalian cells, the construct was cloned via the EcoRI site into the cytomegalovirus promoter-driven pCB6 expression vector.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCB6-Cor1-HA was a gift from Jean Pieters (Addgene plasmid # 102815 ; http://n2t.net/addgene:102815 ; RRID:Addgene_102815) -
For your References section:
Association of the leukocyte plasma membrane with the actin cytoskeleton through coiled coil-mediated trimeric coronin 1 molecules. Gatfield J, Albrecht I, Zanolari B, Steinmetz MO, Pieters J. Mol Biol Cell. 2005 Jun;16(6):2786-98. Epub 2005 Mar 30. 10.1091/mbc.e05-01-0042 PubMed 15800061