Skip to main content

Hy_pMT Laccase2 MCS-WT Split GFP
(Plasmid #69891)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69891 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    Hy_pMT
  • Backbone size w/o insert (bp) 7143
  • Total vector size (bp) 9377
  • Vector type
    Insect Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GFP, laccase2
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    2234
  • Entrez Gene
    stw (a.k.a. Dmel_CG42345, CG10398, CG10408, CG30437, CG32838, CG42345, Dmel\CG42345, Dmel_CG30437, Dmel_CG32838, Laccase2, MCO2, laccase2, str)
  • Promoter Metallothionein Promoter (pMT)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CACTCGAATTTGGAGCCGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Hy_pMT Laccase2 MCS-WT Split GFP was a gift from Jeremy Wilusz (Addgene plasmid # 69891 ; http://n2t.net/addgene:69891 ; RRID:Addgene_69891)
  • For your References section:

    Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins. Kramer MC, Liang D, Tatomer DC, Gold B, March ZM, Cherry S, Wilusz JE. Genes Dev. 2015 Oct 8. 10.1101/gad.270421.115 PubMed 26450910