pECFP-C1-rGAT
(Plasmid
#70108)
-
Purposemammalian expression of rat GAT with N terminal CFP fusion
-
Depositing Lab
-
Depositing OrganizationMedical University of Vienna
Located in Austria -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 70108 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 70108-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 70108-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepECFP-C1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGAT
-
SpeciesR. norvegicus (rat)
-
Entrez GeneSlc6a1 (a.k.a. Gabt1, Gat1)
- Promoter CMV
-
Tag
/ Fusion Protein
- ECFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (destroyed during cloning)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer pEGFP-R: acctctacaaatgtggtatg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 70108-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 70108-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pECFP-C1-rGAT was a gift from Harald Sitte (Addgene plasmid # 70108 ; http://n2t.net/addgene:70108 ; RRID:Addgene_70108) -
For your References section:
Mutations within an intramembrane leucine heptad repeat disrupt oligomer formation of the rat GABA transporter 1. Scholze P, Freissmuth M, Sitte HH. J Biol Chem. 2002 Nov 15;277(46):43682-90. Epub 2002 Sep 9. 10.1074/jbc.M205602200 PubMed 12223478
