Skip to main content

pmCherry-C1-MKLP1
(Plasmid #70154)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 70154 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 70154-D50 50 μg of DNA in Tris buffer $495
DNA 70154-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pmCherry-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4722
  • Total vector size (bp) 7274
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MKLP1
  • Alt name
    kinesin family member 23
  • Alt name
    KIF23
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2574
  • Entrez Gene
    KIF23 (a.k.a. CDA3, CDAIII, CDAN3, CDAN3A, CHO1, KNSL5, MKLP-1, MKLP1)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer Cherry-F ccccgtaatgcagaagaaga
  • 3′ sequencing primer SV40pA-R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note that there are two silent mutations at position 2673 and 4203. The former is an artificial SalI site and the latter a polymorphism (I think). They also have Gly (GGG) artificially inserted between the starting methionine and the lysine 2.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmCherry-C1-MKLP1 was a gift from Masanori Mishima (Addgene plasmid # 70154 ; http://n2t.net/addgene:70154 ; RRID:Addgene_70154)
  • For your References section:

    ARF6 GTPase protects the post-mitotic midbody from 14-3-3-mediated disintegration. Joseph N, Hutterer A, Poser I, Mishima M. EMBO J. 2012 May 30;31(11):2604-14. doi: 10.1038/emboj.2012.139. Epub 2012 May 11. 10.1038/emboj.2012.139 PubMed 22580824