pTT3 Flrt2-myc
(Plasmid
#72192)
-
PurposeExpress full-length Flrt2with a C-terminal myc tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72192 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepTT3
-
Backbone manufacturerYves Durocher, National Research Council of Canada-Biotechnology Research Institute
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFlrt2
-
Alt nameFibronectin leucine rich transmembrane protein 2
-
Alt nameNCBI gene ID 399558; Reference sequence NM_201518.4
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2016
-
Entrez GeneFlrt2
- Promoter CMV
-
Tag
/ Fusion Protein
- myc (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site SpeI (destroyed during cloning)
- 5′ sequencing primer CAGTTTCCAAAAACGAGGAGG
- 3′ sequencing primer TATGTCCTTCCGAGTGAGAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTT3 Flrt2-myc was a gift from Woj Wojtowicz (Addgene plasmid # 72192 ; http://n2t.net/addgene:72192 ; RRID:Addgene_72192) -
For your References section:
An extracellular biochemical screen reveals that FLRTs and Unc5s mediate neuronal subtype recognition in the retina. Visser JJ, Cheng Y, Perry SC, Chastain AB, Parsa B, Masri SS, Ray TA, Kay JN, Wojtowicz WM. Elife. 2015 Dec 3;4. pii: e08149. doi: 10.7554/eLife.08149. 10.7554/eLife.08149 PubMed 26633812