PX458_ATF4_1
(Plasmid
#72351)
-
PurposeEncodes gRNA for 3' target of human ATF4 along with Cas9 with 2A GFP
-
Depositing Labs
-
Depositing OrganizationUniversity of Alabama in Huntsville
Located in the United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72351 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 72351-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 72351-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonePX458
- Backbone size w/o insert (bp) 9289
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATF4
-
gRNA/shRNA sequenceGCCCCTAGTTGAGGATAGTC
-
SpeciesH. sapiens (human)
-
Entrez GeneATF4 (a.k.a. CREB-2, CREB2, TAXREB67, TXREB)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer pBR322ori-F
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: This plasmid is part of the Mendenhall and Meyers CRISPR-based Tagging system to add a tag (currently using FLAG) to endogenous proteins. Please see https://www.addgene.org/crispr/tagging/ for more details.
DNA (Catalog # 72351-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 72351-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX458_ATF4_1 was a gift from Eric Mendenhall & Richard M. Myers (Addgene plasmid # 72351 ; http://n2t.net/addgene:72351 ; RRID:Addgene_72351)