Skip to main content

pDECKO_TFRC_B
(Plasmid #72626)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 72626 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 72626-D50 50 μg of DNA in Tris buffer $495
DNA 72626-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    Lentiguide-puro
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNAs toward TFRC
  • gRNA/shRNA sequence
    gRNA1:GCAGCCTCAGAAATACAAAA, gRNA2CGGGATATCGGGTGGCGGCT
  • Species
    H. sapiens (human)
  • Promoter U6 (gRNA1) and H1 (gRNA2)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer hU6-F (5'-GAGGGCCTATTTCCCATGATT-3')
  • 3′ sequencing primer hGata4-rev (5'-ATTGTGGATGAATACTGCC-3')
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDECKO_TFRC_B was a gift from Roderic Guigo & Rory Johnson (Addgene plasmid # 72626 ; http://n2t.net/addgene:72626 ; RRID:Addgene_72626)
  • For your References section:

    DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. Aparicio-Prat E, Arnan C, Sala I, Bosch N, Guigo R, Johnson R. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z. 10.1186/s12864-015-2086-z [pii] PubMed 26493208