pDECKO_TFRC_C (with mCherry)
(Plasmid
#72627)
-
PurposeExpresses two gRNAs targeting the TFRC promoter
-
Depositing Labs
-
Depositing OrganizationCentre for Genomic Regulation (CRG)
Located in Spain -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72627 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 72627-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 72627-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepDECKO-mCherry
- Backbone size w/o insert (bp) 9400
-
Modifications to backboneInserted T2A-mCherry downstream of EF1alpha-PuroR cassette
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNAs toward TFRC
-
gRNA/shRNA sequencegRNA1:GGGGAGCGGGAAAGCGGTCG; gRNA2:AACTGACCTTCAGGCCCGTA
-
SpeciesH. sapiens (human)
- Promoter U6 (gRNA1) and H1 (gRNA2)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer hU6-F (5'-GAGGGCCTATTTCCCATGATT-3')
- 3′ sequencing primer hGata4-rev (5'-ATTGTGGATGAATACTGCC-3')
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 72627-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 72627-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDECKO_TFRC_C (with mCherry) was a gift from Roderic Guigo & Rory Johnson (Addgene plasmid # 72627 ; http://n2t.net/addgene:72627 ; RRID:Addgene_72627) -
For your References section:
DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. Aparicio-Prat E, Arnan C, Sala I, Bosch N, Guigo R, Johnson R. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z. 10.1186/s12864-015-2086-z [pii] PubMed 26493208