Gg 3kb Green opsin GFP
(Plasmid
#72919)
-
Purposegreen opsin promoter from chicken (Gallus gallus) gDNA chr26:4,504,913–4,501,931 in galGal4 driving GFP
-
Depositing Lab
-
Depositing OrganizationWashington University in Saint Louis
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72919 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 72919-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 72919-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCAGGS
-
Modifications to backboneno basal GFP Hsiau TH, Diaconu C, Myers CA, Lee J, Cepko CL, Corbo JC.2007. The cis-regulatory logic of the mammalian photore-ceptor transcriptional network. PloS One 2:e643.
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namechicken green opsin promoter
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)2967
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer TGTGACAGGGACACTGAAGG
- 3′ sequencing primer TATTATGGCAGCTGCTTTGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 72919-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 72919-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Gg 3kb Green opsin GFP was a gift from Joseph Corbo (Addgene plasmid # 72919 ; http://n2t.net/addgene:72919 ; RRID:Addgene_72919) -
For your References section:
Transcriptome profiling of developing photoreceptor subtypes reveals candidate genes involved in avian photoreceptor diversification. Enright JM, Lawrence KA, Hadzic T, Corbo JC. J Comp Neurol. 2015 Mar 1;523(4):649-68. doi: 10.1002/cne.23702. Epub 2014 Dec 1. 10.1002/cne.23702 PubMed 25349106
