pLX_305_Ovalbumin
(Plasmid #184924)

• Purpose: Lentiviral vector for expressing Ovalbumin. Also expresses the puromycin resistance gene as a selectable marker.
• Depositing Lab: Arlene Sharpe
• Publication: Milling et al J Exp Med. 2024 Apr 1;221(4):e20230699. doi: 10.1084/jem.20230699. Epub 2024 Feb 27.

Backbone

• Vector backbone: pLX_305
• Backbone manufacturer: Broad Institute Genetic Perturbation Platform
• Backbone size w/o insert (bp): 7555
• Total vector size (bp): 8716
• Modifications to backbone: Cloned in Ovalbumin after the PGK promoter.
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ovalbumin
• Species: G. gallus (chicken)
• Insert Size (bp): 1161
• Mutation: Our vector has an A188T mutation that does not impact SIINFEKL presentation or responses.
• GenBank ID: 396058
• Entrez Gene: OVAL (a.k.a. OVA, SERPINB14)
• Promoter: PGK

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: TAAGTCGGGAAGGTTCCTTGCG

Resource Information

• Supplemental Documents:
  • plx_305_ovalbumin.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry