-
PurposeExpresses BE1 with C-terminal NLS in mammalian cells
-
Depositing Lab
-
Depositing OrganizationHarvard University
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73019 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 73019-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 73019-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneCMV
-
Backbone manufacturerorigene
- Backbone size w/o insert (bp) 3399
- Total vector size (bp) 8271
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameBE1
-
Alt namerAPOBEC1-XTEN-dCas9-NLS
-
SpeciesR. norvegicus (rat); S. pyogenes
-
Insert Size (bp)4872
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CMV
- 3′ sequencing primer TGGTTCTTTCCGCCTCAGAAGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 73019-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 73019-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-BE1 was a gift from David Liu (Addgene plasmid # 73019 ; http://n2t.net/addgene:73019 ; RRID:Addgene_73019) -
For your References section:
Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Komor AC, Kim YB, Packer MS, Zuris JA, Liu DR. Nature. 2016 Apr 20. doi: 10.1038/nature17946. 10.1038/nature17946 PubMed 27096365