hPlekhm1_pIRES puro Glue
(Plasmid
#73453)
-
PurposeExpress human Plekhm1 in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of Massachusetts, Worcester
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73453 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 73453-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 73453-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepIRES puro Glue vector
-
Backbone manufacturerAddgene, vector number 15100
- Backbone size w/o insert (bp) 5481
- Total vector size (bp) 8652
-
Modifications to backbonethe original vector was digested with EcoRV and Not1 to insert Plekhm1
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePlekhm1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3171
-
GenBank IDNM_014798.2
-
Entrez GenePLEKHM1 (a.k.a. AP162, B2, OPTA3, OPTB6)
-
Tags
/ Fusion Proteins
- strep tag (N terminal on backbone)
- HA tag (N terminal on backbone)
- CBP tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer TGGCGAGAACCTGTACTTCCAG
- 3′ sequencing primer CAAGTGTATGGCCAGATCTCAAGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 73453-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 73453-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hPlekhm1_pIRES puro Glue was a gift from Paul Odgren (Addgene plasmid # 73453 ; http://n2t.net/addgene:73453 ; RRID:Addgene_73453) -
For your References section:
TRAFD1 (FLN29) Interacts with Plekhm1 and Regulates Osteoclast Acidification and Resorption. Witwicka H, Jia H, Kutikov A, Reyes-Gutierrez P, Li X, Odgren PR. PLoS One. 2015 May 19;10(5):e0127537. doi: 10.1371/journal.pone.0127537. eCollection 2015. 10.1371/journal.pone.0127537 PubMed 25992615