Skip to main content

pZY101
(Plasmid #73932)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73932 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pPZP201
  • Backbone size w/o insert (bp) 7132
  • Total vector size (bp) 8838
  • Modifications to backbone
    bar gene and hpRNA expression cassettes were inserted.
  • Vector type
    Plant Expression
  • Selectable markers
    Basta ; bar

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Growth condition for Agrobacterium carrying this plasmid is at 28 C. SmR gene confers resistance to spectinomycin and streptomycin in bacteria
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    bar
  • Alt name
    PAT
  • Species
    Synthetic
  • Insert Size (bp)
    567
  • Promoter 35S

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho (not destroyed)
  • 3′ cloning site Hind III (not destroyed)
  • 5′ sequencing primer GAAACCTCCTCGGATTCCAT
  • 3′ sequencing primer CAGCAGGTGGGTGTAGAGCGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This vector is suitable hpRNA-mediated gene silencing in tissue (seed) specific manner.

Please see the Plant Transformation Core Facility website for more information on using this plasmid: http://plantsci.missouri.edu/muptcf/pzy101.html

The vector has following features:

1. It has two replicate origins that allow to replicate in both E. coli and Agrobacterium tumefaciens cells (at higher copy numbers).
2. It also has bom site that allows you to use tri-parental mating to mobilize the vector to Agrobacterium cells.
3. The aadA locus confers Spectinomycin (100 mg/L) or streptomycin (100 mg/L) resistance and thus enable to use either or both of these two antibiotics for the vector selection.
4. The multiple cloning site (MCS) adjacent to the double CaMV35S promoter will allow you to insert your cassette. This CaMV35S promoter is used to drive the bar ORF and, therefore, is not used in front to drive your gene of interest. You need to assemble your own expression cassette including promoter, gene coding sequence, and terminator, and then insert to anywhere between Hind III and EcoR I within the MCS.

Special notes:

1. Insert your gene expression cassette in such a way that your promoter is adjacent to the promoter driving the bar gene selectable marker. This is to prevent transcription read-through from your gene expression cassette.
2. In order to use the EcoR I site within the MCS, a minimal ratio of this enzyme versus DNA is recommended to avoid star activity. When HindIII and EcoRI are in combined use, even less of each enzyme is required, and reaction should be conducted in a large volume to avoid excessive enzymatic activity.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZY101 was a gift from Zhanyuan Zhang (Addgene plasmid # 73932 ; http://n2t.net/addgene:73932 ; RRID:Addgene_73932)
  • For your References section:

    Refined glufosinate selection in Agrobacterium-mediated transformation of soybean [Glycine max (L.) Merrill]. Zeng P, Vadnais DA, Zhang Z, Polacco JC. Plant Cell Rep. 2004 Feb;22(7):478-82. Epub 2003 Sep 30. 10.1007/s00299-003-0712-8 PubMed 15034747