Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRU61
(Plasmid #167692)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 167692 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDe-CAS9
  • Vector type
    CRISPR
  • Selectable markers
    FastRed seed selection

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Spectinomycin, 25 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pEC1.2::asCpf1
  • Species
    Staphylococcus aureus

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gcggataacaatttcacacaggaaacag
  • 3′ sequencing primer gcttgcatgcctgcaggtcgactct
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

In addition to Cas9 cassette, attR1-attR2 Gateway recombination sites together with ccdB cassette are present.

Please visit https://www.biorxiv.org/content/10.1101/2021.05.20.444986v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRU61 was a gift from Niko Geldner (Addgene plasmid # 167692 ; http://n2t.net/addgene:167692 ; RRID:Addgene_167692)
  • For your References section:

    Combined fluorescent seed selection and multiplex CRISPR/Cas9 assembly for fast generation of multiple Arabidopsis mutants. Ursache R, Fujita S, Denervaud Tendon V, Geldner N. Plant Methods. 2021 Oct 30;17(1):111. doi: 10.1186/s13007-021-00811-9. 10.1186/s13007-021-00811-9 PubMed 34717688