GFP-nArgBP2
(Plasmid
#74514)
-
PurposeExpress GFP-nArgBP2 fusion protein in mammalian cells
-
Depositing Lab
-
Depositing OrganizationMassachusetts Institute of Technology
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74514 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 74514-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 74514-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-C2
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenArgBP2
-
Alt nameSorbs2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3774
-
GenBank IDKR610443.1
-
Entrez GeneSorbs2 (a.k.a. 2010203O03Rik, 9430041O17Rik, A530071H08, Argbp2, mKIAA0777, nArgBP2)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer CAAATGTGGTATGGCTGATT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 74514-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 74514-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-nArgBP2 was a gift from Guoping Feng (Addgene plasmid # 74514 ; http://n2t.net/addgene:74514 ; RRID:Addgene_74514) -
For your References section:
Impaired Dendritic Development and Memory in Sorbs2 Knock-Out Mice. Zhang Q, Gao X, Li C, Feliciano C, Wang D, Zhou D, Mei Y, Monteiro P, Anand M, Itohara S, Dong X, Fu Z, Feng G. J Neurosci. 2016 Feb 17;36(7):2247-60. doi: 10.1523/JNEUROSCI.2528-15.2016. 10.1523/JNEUROSCI.2528-15.2016 PubMed 26888934