pJM104: pTrc RFP on pCM66T
(Plasmid
#74745)
-
PurposepCM66T with promoter pTrc driving RFP expression (maxRFP = BBa_E1010)
-
Depositing Lab
-
Depositing OrganizationUniversity of Washington
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74745 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 74745-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 74745-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCM66T (Addgene #74738)
- Backbone size w/o insert (bp) 5316
- Total vector size (bp) 6214
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRFP (BioBrick part number BBa_E1010)
-
Alt namemaxRFP, mRFP
-
Insert Size (bp)898
- Promoter pTrc
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgattcattaatgcagctggcac
- 3′ sequencing primer cctctgacacatgcagctccc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
One of a series of plasmids with promoters of differing strengths in Methylovorous glucosetrophus SIP3-4, a RuMP cycle methylotroph:
Addgene # 74738: empty vector, made from pCM66.
Addgene # 74739: pJM100: no-promoter RFP control. Made from pCM66D (AddGene #74738)
Addgene # 74740: pJM101: pHps1 RFP on pCM66T
Addgene # 74741: pJM102: pHps2 RFP on pCM66T
Addgene # 74744: pJM103: 150bp Hps2 RFP on pCM66T
Addgene # 74745: pJM104: pTrc RFP on pCM66T
Addgene # 74746: pJM105: pTac RFP on pCM66T
Backbone is similar backbone to pAWP78 (AddGene plasmid 61263)
DNA (Catalog # 74745-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 74745-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJM104: pTrc RFP on pCM66T was a gift from Mary Lidstrom (Addgene plasmid # 74745 ; http://n2t.net/addgene:74745 ; RRID:Addgene_74745)
Map uploaded by the depositor.
