Skip to main content

pSpal2At
(Plasmid #78286)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78286 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pSTV28
  • Backbone size w/o insert (bp) 2999
  • Total vector size (bp) 5127
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    PAL2
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    2154
  • Mutation
    *see below
  • Entrez Gene
    PAL2 (a.k.a. AT3G53260, ATPAL2, phenylalanine ammonia-lyase 2)
  • Promoter lac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SphI (not destroyed)
  • 5′ sequencing primer ctatgaccatgattacgaattc
  • 3′ sequencing primer CCAGTGCCAAGCTTGCATGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

*Note: Addgene's quality control sequencing finds an E50A amino acid residue substitution in the A. thaliana PAL2 gene insert. The depositing laboratory does not believe this residue change will affect protein function. This plasmid accurately reflects the construct as it was used in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSpal2At was a gift from David Nielsen (Addgene plasmid # 78286 ; http://n2t.net/addgene:78286 ; RRID:Addgene_78286)
  • For your References section:

    Styrene biosynthesis from glucose by engineered E. coli. McKenna R, Nielsen DR. Metab Eng. 2011 Sep;13(5):544-54. doi: 10.1016/j.ymben.2011.06.005. Epub 2011 Jun 23. 10.1016/j.ymben.2011.06.005 PubMed 21722749