pCRISPRainbow-DONOR1
(Plasmid
#75398)
-
PurposeCRISPRainbow-DONOR1
-
Depositing Lab
-
Depositing OrganizationUniversity of Massachusetts, Worcester
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 75398 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 75398-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 75398-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2000
- Total vector size (bp) 3524
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCm(R)-CcdB
- Promoter Bacteria
-
Tag
/ Fusion Protein
- no
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Mlu I (not destroyed)
- 3′ cloning site Pci I (not destroyed)
- 5′ sequencing primer GCTACAACAAGGCAAGGCTTGACCGA
- 3′ sequencing primer AACGCCAGCAACGCGGCCTT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Want all of the CRISPRainbow constructs? Request the set here: https://www.addgene.org/kits/pederson-crisprainbow/
DNA (Catalog # 75398-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 75398-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPRainbow-DONOR1 was a gift from Thoru Pederson (Addgene plasmid # 75398 ; http://n2t.net/addgene:75398 ; RRID:Addgene_75398) -
For your References section:
Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Ma H, Tu LC, Naseri A, Huisman M, Zhang S, Grunwald D, Pederson T. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. 10.1038/nbt.3526 PubMed 27088723