Skip to main content

pCas9-VRER_2A_GFP
(Plasmid #75475)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75475 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 75475-D50 50 μg of DNA in Tris buffer $495
DNA 75475-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCAG
  • Backbone size w/o insert (bp) 4200
  • Total vector size (bp) 9271
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cas9-VRER
  • Species
    Synthetic; human codon-optimized
  • Insert Size (bp)
    4137
  • Mutation
    D1135V, G1218R, R1335E, T1337R
  • Promoter CAG
  • Tag / Fusion Protein
    • 2A_GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site None (destroyed during cloning)
  • 5′ sequencing primer ggctctagtgcctctgctaacc
  • 3′ sequencing primer M13R
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Plasmid is modified from pCas9_GFP, originally received from Addgene (Plasmid #44719), please check MTA for original plasmid.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCas9-VRER_2A_GFP was a gift from Marc Tessier-Lavigne (Addgene plasmid # 75475 ; http://n2t.net/addgene:75475 ; RRID:Addgene_75475)
  • For your References section:

    Efficient introduction of specific homozygous and heterozygous mutations using CRISPR/Cas9. Paquet D, Kwart D, Chen A, Sproul A, Jacob S, Teo S, Olsen KM, Gregg A, Noggle S, Tessier-Lavigne M. Nature. 2016 May 5;533(7601):125-9. doi: 10.1038/nature17664. Epub 2016 Apr 27. 10.1038/nature17664 PubMed 27120160