-
PurposeCo-expression of human codon-optimized Cas9 nuclease and GFP, plasmid optimized for expression in human pluripotent stem cells
-
Depositing Lab
-
Depositing OrganizationHarvard University
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 44719 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 44719-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 44719-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 4200
- Total vector size (bp) 9271
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9-2A-GFP
-
SpeciesSynthetic
-
Insert Size (bp)4926
- Promoter CAG
-
Tag
/ Fusion Protein
- 2A-GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer ggctctagtgcctctgctaacc
- 3′ sequencing primer M13R
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byGeorge Church
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information on Musunuru Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Musunuru/
DNA (Catalog # 44719-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 44719-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCas9_GFP was a gift from Kiran Musunuru (Addgene plasmid # 44719 ; http://n2t.net/addgene:44719 ; RRID:Addgene_44719) -
For your References section:
Enhanced efficiency of human pluripotent stem cell genome editing through replacing TALENs with CRISPRs. Ding Q, Regan SN, Xia Y, Oostrom LA, Cowan CA, Musunuru K. Cell Stem Cell. 2013 Apr 4;12(4):393-4. doi: 10.1016/j.stem.2013.03.006. 10.1016/j.stem.2013.03.006 PubMed 23561441