Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCas9_GFP
(Plasmid #44719)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 44719 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAG
  • Backbone size w/o insert (bp) 4200
  • Total vector size (bp) 9271
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cas9-2A-GFP
  • Species
    Synthetic
  • Insert Size (bp)
    4926
  • Promoter CAG
  • Tag / Fusion Protein
    • 2A-GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer ggctctagtgcctctgctaacc
  • 3′ sequencing primer M13R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For more information on Musunuru Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Musunuru/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCas9_GFP was a gift from Kiran Musunuru (Addgene plasmid # 44719 ; http://n2t.net/addgene:44719 ; RRID:Addgene_44719)
  • For your References section:

    Enhanced efficiency of human pluripotent stem cell genome editing through replacing TALENs with CRISPRs. Ding Q, Regan SN, Xia Y, Oostrom LA, Cowan CA, Musunuru K. Cell Stem Cell. 2013 Apr 4;12(4):393-4. doi: 10.1016/j.stem.2013.03.006. 10.1016/j.stem.2013.03.006 PubMed 23561441