GRK7 gRNA (BRDN0001148138)
(Plasmid
#76501)
-
Purpose3rd generation lentiviral gRNA plasmid targeting human GRK7
-
Depositing Labs
-
Depositing OrganizationBroad Institute
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 76501 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonelentiGuide-Puro
-
Backbone manufacturerZhang Lab (Addgene plasmid # 52963)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGRK7
-
Alt nameGRK7
-
Alt nameNM_139209.2
-
gRNA/shRNA sequenceCAGATAACCTGCAGTTGCCG
-
SpeciesH. sapiens (human)
-
Entrez GeneGRK7 (a.k.a. GPRK7)
- Promoter hU6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer U6-F
- 3′ sequencing primer pS2-R
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The gRNA was designed to target the following Genbank reference sequence(s): NM_139209.2. Note that this plasmid does NOT contain Cas9. It should be used in conjunction with lentiCas9-Blast (Addgene #52962) or otherwise with cell lines already expressing Cas9. Browse the full kinome gRNA library at http://www.addgene.org/pooled-library/broadgpp-human-kinome/ or visit http://www.broadinstitute.org/rnai/public/ for detailed protocols and information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GRK7 gRNA (BRDN0001148138) was a gift from John Doench & David Root (Addgene plasmid # 76501 ; http://n2t.net/addgene:76501 ; RRID:Addgene_76501) -
For your References section:
Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Doench JG, Fusi N, Sullender M, Hegde M, Vaimberg EW, Donovan KF, Smith I, Tothova Z, Wilen C, Orchard R, Virgin HW, Listgarten J, Root DE. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437. 10.1038/nbt.3437 PubMed 26780180