Skip to main content

ATP23 gRNA (BRDN0001145935)
(Plasmid #77435)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 77435 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    lentiGuide-Puro
  • Backbone manufacturer
    Zhang Lab (Addgene plasmid # 52963)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATP23
  • Alt name
    ATP23
  • gRNA/shRNA sequence
    TCAGGCCCATATGAACAGAG
  • Species
    H. sapiens (human)
  • Entrez Gene
    XRCC6BP1 (a.k.a. KUB3, MGC134817, MGC134818)
  • Promoter hU6

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The gRNA was designed to target a Genbank reference sequence which has since been removed from the database. Note that this plasmid does NOT contain Cas9. It should be used in conjunction with lentiCas9-Blast (Addgene #52962) or otherwise with cell lines already expressing Cas9. Browse the full kinome gRNA library at http://www.addgene.org/pooled-library/broadgpp-human-kinome/ or visit http://www.broadinstitute.org/rnai/public/ for detailed protocols and information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ATP23 gRNA (BRDN0001145935) was a gift from John Doench & David Root (Addgene plasmid # 77435 ; http://n2t.net/addgene:77435 ; RRID:Addgene_77435)
  • For your References section:

    Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Doench JG, Fusi N, Sullender M, Hegde M, Vaimberg EW, Donovan KF, Smith I, Tothova Z, Wilen C, Orchard R, Virgin HW, Listgarten J, Root DE. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437. 10.1038/nbt.3437 PubMed 26780180