625_HOXD13 in pmiRGlo
(Plasmid
#78129)
-
Purposeluciferase reporter for miRNA activity
-
Depositing Lab
-
Depositing OrganizationUniversitaetsklinikum Hamburg-Eppendorf
Located in Germany -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78129 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 78129-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 78129-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepmiRGlo
-
Backbone manufacturerPromega
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHOXD13
-
SpeciesH. sapiens (human)
-
Mutation3'UTR containing miRNA binding sites
-
Entrez GeneHOXD13 (a.k.a. BDE, BDSD, HOX4I, SPD, SPD1)
- Promoter PGK
-
Tag
/ Fusion Protein
- luciferase (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer Fluc-F1 (AGAAGCTGCGCGGTGGTGTTGTG)
- 3′ sequencing primer T7terminal
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 78129-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 78129-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
625_HOXD13 in pmiRGlo was a gift from Heidi Schwarzenbach (Addgene plasmid # 78129 ; http://n2t.net/addgene:78129 ; RRID:Addgene_78129) -
For your References section:
Increased serum levels of circulating exosomal microRNA-373 in receptor-negative breast cancer patients. Eichelser C, Stuckrath I, Muller V, Milde-Langosch K, Wikman H, Pantel K, Schwarzenbach H. Oncotarget. 2014 Oct 30;5(20):9650-63. 10.18632/oncotarget.2520 PubMed 25333260