Skip to main content

pPR220.08
(Plasmid #78553)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78553 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 78553-D50 50 μg of DNA in Tris buffer $495
DNA 78553-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    p15A
  • Backbone size w/o insert (bp) 2000
  • Total vector size (bp) 6544
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    uirS
  • Alt name
    ETR1
  • Alt name
    slr1212
  • Species
    Synechocystis sp. PCC 6803
  • Insert Size (bp)
    2535
  • Promoter J23108

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GAGCGTAGCGAGTCAGTGAG
  • 3′ sequencing primer ATCGACACGAATTATGCAGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPR220.08 was a gift from Jeffrey Tabor (Addgene plasmid # 78553 ; http://n2t.net/addgene:78553 ; RRID:Addgene_78553)
  • For your References section:

    Repurposing Synechocystis PCC6803 UirS-UirR as a UV-violet/green photoreversible transcriptional regulatory tool in E. coli. Ramakrishnan P, Tabor JJ. ACS Synth Biol. 2016 Apr 27. 10.1021/acssynbio.6b00068 PubMed 27120220