Skip to main content

mCherry-Rab9a
(Plasmid #78592)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78592 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    mCherry2-C1
  • Backbone size w/o insert (bp) 4750
  • Total vector size (bp) 5400
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rab9a
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    678
  • GenBank ID
    NM_004251
  • Entrez Gene
    RAB9A (a.k.a. RAB9)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GCTGCAATAAACAAGTTAAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We received this vector from Michael Davidson (Addgene plasmid # 54563) and inserted Rab9a PCR from GFP-rab9 WT (Richard Pagano, Addgene plasmid #12663)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCherry-Rab9a was a gift from Yihong Ye (Addgene plasmid # 78592 ; http://n2t.net/addgene:78592 ; RRID:Addgene_78592)
  • For your References section:

    Unconventional secretion of misfolded proteins promotes adaptation to proteasome dysfunction in mammalian cells. Lee JG, Takahama S, Zhang G, Tomarev SI, Ye Y. Nat Cell Biol. 2016 Jul;18(7):765-76. doi: 10.1038/ncb3372. Epub 2016 Jun 13. 10.1038/ncb3372 PubMed 27295555