-
PurposehGem(1/110) fused with near-infrared fluorescent protein miRFP670v1 (S/G2/M phase cell cycle reporter)
-
Depositing Lab
-
Depositing OrganizationAlbert Einstein College of Medicine
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80006 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCSII-EF-MCS
-
Backbone manufacturerDr. Hiroyuki Miyoshi (RIKEN, Tsukuba, Japan)
- Total vector size (bp) 10483
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehGeminin (1/110)
-
SpeciesH. sapiens (human)
-
Entrez GeneGMNN (a.k.a. Gem, MGORS6)
- Promoter EF-1 alpha
-
Tag
/ Fusion Protein
- miRFP670v1 (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ggttcattctcaagcctcagacagtgg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe original plasmids for cell cycle analysis (Fucci system, Cell, 2008; 132:487-98) were created by Dr. Atsushi Miyawaki (RIKEN Brain Science Institute, Saitama, Japan)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCSII-EF-miRFP670v1-hGem(1/110) was a gift from Vladislav Verkhusha (Addgene plasmid # 80006 ; http://n2t.net/addgene:80006 ; RRID:Addgene_80006) -
For your References section:
Bright monomeric near-infrared fluorescent proteins as tags and biosensors for multiscale imaging. Shcherbakova DM, Baloban M, Emelyanov AV, Brenowitz M, Guo P, Verkhusha VV. Nat Commun. 2016 Aug 19;7:12405. doi: 10.1038/ncomms12405. 10.1038/ncomms12405 PubMed 27539380