Skip to main content
Addgene
Open Menu

pCiVSP-SD64TF
(Plasmid #80332)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80332 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 80332-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 80332-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pSD64TF
  • Backbone size w/o insert (bp) 3250
  • Vector type
    Xenopus Oocyte Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ciona intestinalis voltage-sensing phosphatase
  • Alt name
    Ci-VSP
  • Species
    Ciona intestinalis
  • Insert Size (bp)
    1731
  • GenBank ID
    NM_001033826
  • Entrez Gene
    vsp
  • Promoter SP6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CTTGTTCTTTTTGCAGAAGCTC
  • 3′ sequencing primer ACTCCATTCGGGTGTTCTTGAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCiVSP-SD64TF was a gift from Yasushi Okamura (Addgene plasmid # 80332 ; http://n2t.net/addgene:80332 ; RRID:Addgene_80332)

  • For your References section:

    Phosphoinositide phosphatase activity coupled to an intrinsic voltage sensor. Murata Y, Iwasaki H, Sasaki M, Inaba K, Okamura Y. Nature. 2005 Jun 30;435(7046):1239-43. Epub 2005 May 18. 10.1038/nature03650 PubMed 15902207
Related items:
Commonly requested with: