Skip to main content

pDrVSP-IRES2-EGFP
(Plasmid #80333)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80333 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 80333-D50 50 μg of DNA in Tris buffer $495
DNA 80333-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pIRES2-EGFP
  • Backbone manufacturer
    Clonetech
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Daino rerio voltage-sensing phosphatase
  • Alt name
    Dr-VSP
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    1536
  • GenBank ID
    AB308476
  • Entrez Gene
    tpte (a.k.a. tpip, vsp, wu:fd20e11, wu:fi24b06)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (destroyed during cloning)
  • 3′ cloning site SacII (not destroyed)
  • 5′ sequencing primer GCAGAGCTGGTTTAGTGAACCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDrVSP-IRES2-EGFP was a gift from Yasushi Okamura (Addgene plasmid # 80333 ; http://n2t.net/addgene:80333 ; RRID:Addgene_80333)
  • For your References section:

    Enzyme domain affects the movement of the voltage sensor in ascidian and zebrafish voltage-sensing phosphatases. Hossain MI, Iwasaki H, Okochi Y, Chahine M, Higashijima S, Nagayama K, Okamura Y. J Biol Chem. 2008 Jun 27;283(26):18248-59. doi: 10.1074/jbc.M706184200. Epub 2008 Mar 28. 10.1074/jbc.M706184200 PubMed 18375390