-
Purposeoverexpression of nonconjugative ISG15
-
Depositing Lab
-
Depositing OrganizationInstituto de Salud Carlos III
Located in Spain -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80405 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 80405-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 80405-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV6-Neo
-
Backbone manufacturerOrigene
- Backbone size w/o insert (bp) 5835
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameISG15
-
SpeciesH. sapiens (human)
-
Insert Size (bp)685
-
Mutationnonconjugative ISG15, LRAA
-
GenBank IDNM_005101.3
-
Entrez GeneISG15 (a.k.a. G1P2, IFI15, IMD38, IP17, UCRP, hUCRP)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer hGH-PA-R
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Synthesis of the nonconjugative ISG15 plasmid pCMV6-Neo-ISG15-LRAA from pCMV6-Neo-ISG15 (Addgene plasmid 80404) was performed by directed mutagenesis using the Phusion site-directed mutagenesis kit (Thermo Scientific), following the manufacturer′s instructions, with the following primers: forward, (5′CCTGCGGGCAGCCGGCACAGAGCCTGGCGGGCGGAGC3′), and reverse, (5′GGCTGCCCGCAGGCGCAGATTCATGAACACGGT3′).
DNA (Catalog # 80405-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 80405-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV6-Neo-ISG15-LRAA was a gift from Isidoro Martinez (Addgene plasmid # 80405 ; http://n2t.net/addgene:80405 ; RRID:Addgene_80405) -
For your References section:
ISG15 Is Upregulated in Respiratory Syncytial Virus Infection and Reduces Virus Growth through Protein ISGylation. Gonzalez-Sanz R, Mata M, Bermejo-Martin J, Alvarez A, Cortijo J, Melero JA, Martinez I. J Virol. 2016 Jan 13;90(7):3428-38. doi: 10.1128/JVI.02695-15. 10.1128/JVI.02695-15 PubMed 26763998