-
Purposecreate nuclear protein aggregates in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80625 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonePiggyBac transformation vector pB
- Backbone size w/o insert (bp) 6652
- Total vector size (bp) 7763
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS-NES-L106P-sfGFP
-
Alt nameNLS-AgDD
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1113
-
GenBank IDNM_000801 AB971579
-
Entrez GeneFKBP1A (a.k.a. FKBP-12, FKBP-1A, FKBP1, FKBP12, PKC12, PKCI2, PPIASE)
-
Tag
/ Fusion Protein
- MPPKKKRKVLALKLAGLDI (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HpaI (not destroyed)
- 5′ sequencing primer YM213--5' atgccttcttctttttcctacagct
- 3′ sequencing primer YM215--5' gatgagtttggacaaaccacaact
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Depositor reference sequence and Addgene Sanger results show F36V compared to NM_000801.4.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NLS-AgDD was a gift from Thomas Wandless (Addgene plasmid # 80625 ; http://n2t.net/addgene:80625 ; RRID:Addgene_80625) -
For your References section:
A method to rapidly create protein aggregates in living cells. Miyazaki Y, Mizumoto K, Dey G, Kudo T, Perrino J, Chen LC, Meyer T, Wandless TJ. Nat Commun. 2016 May 27;7:11689. doi: 10.1038/ncomms11689. 10.1038/ncomms11689 PubMed 27229621