Skip to main content
Addgene
Open Menu

AAVS1-Pur-CAG-hM4Di-mCherry
(Plasmid #80947)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80947 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 80947-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 80947-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    AAVS1
  • Backbone size w/o insert (bp) 10247
  • Total vector size (bp) 12416
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hM4Di-mCherry
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2169
  • Promoter CAG promoter
  • Tag / Fusion Protein
    • mcherry fusion (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer ggcttctggcgtgtgaccggc
  • 3′ sequencing primer catagcgtaaaaggagcaaca
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The hM4Di-mCherry cDNA was amplified from pAAV-hSyn-DIO-hM4D(Gi)-mCherry (addgene #44362, Bryan Roth Lab)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-Pur-CAG-hM4Di-mCherry was a gift from Su-Chun Zhang (Addgene plasmid # 80947 ; http://n2t.net/addgene:80947 ; RRID:Addgene_80947)

  • For your References section:

    Chemical Control of Grafted Human PSC-Derived Neurons in a Mouse Model of Parkinson's Disease. Chen Y, Xiong M, Dong Y, Haberman A, Cao J, Liu H, Zhou W, Zhang SC. Cell Stem Cell. 2016 Jun 2;18(6):817-26. doi: 10.1016/j.stem.2016.03.014. Epub 2016 Apr 28. 10.1016/j.stem.2016.03.014 PubMed 27133795
Related items:
Commonly requested with: