pTriEx-mVenus-Zdk1-RhoA Q63L
(Plasmid
#81046)
-
Purposemammalian expression of Zdk1 tagged RhoA Q63L
-
Depositing Lab
-
Depositing OrganizationUniversity of North Carolina at Chapel Hill
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 81046 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 81046-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 81046-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepTriEx
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 6000
-
Vector typeMammalian Expression, Bacterial Expression, Insect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameZdk1
-
Alt nameZA127
-
SpeciesSynthetic
-
Insert Size (bp)177
-
Tag
/ Fusion Protein
- mVenus (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer TGCCCGACAACCACTACCTGA
- 3′ sequencing primer GGCAGCCTGCACCTGAGGTTAATCAC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameRhoA Q63L
-
SpeciesH. sapiens (human)
-
Entrez GeneRHOA (a.k.a. ARH12, ARHA, EDFAOB, RHO12, RHOH12)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer TGCCCGACAACCACTACCTGA
- 3′ sequencing primer GGCAGCCTGCACCTGAGGTTAATCAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 81046-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 81046-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTriEx-mVenus-Zdk1-RhoA Q63L was a gift from Klaus Hahn (Addgene plasmid # 81046 ; http://n2t.net/addgene:81046 ; RRID:Addgene_81046) -
For your References section:
LOVTRAP: an optogenetic system for photoinduced protein dissociation. Wang H, Vilela M, Winkler A, Tarnawski M, Schlichting I, Yumerefendi H, Kuhlman B, Liu R, Danuser G, Hahn KM. Nat Methods. 2016 Jul 18. doi: 10.1038/nmeth.3926. 10.1038/nmeth.3926 PubMed 27427858