pconst #5-RFP
(Plasmid
#81079)
-
Purposeconstitutive promoter expressing RFP, biobrick construction
-
Depositing Labs
-
Depositing OrganizationLawrence Berkeley National Laboratory
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 81079 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 81079-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 81079-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepBbA0k-RFP
- Backbone size w/o insert (bp) 2099
- Total vector size (bp) 2777
-
Vector typeP15A origin, Constitutive promoter, kanR
-
Selectable markersKan
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsmedium copy
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRFP
-
Insert Size (bp)678
- Promoter Constitutive Promoter - BBa_J23110
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer tttacggctagctcagtcctaggtacaatgctagc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 81079-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 81079-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pconst #5-RFP was a gift from Paul Adams & Jay Keasling (Addgene plasmid # 81079 ; http://n2t.net/addgene:81079 ; RRID:Addgene_81079) -
For your References section:
Engineering dynamic pathway regulation using stress-response promoters. Dahl RH, Zhang F, Alonso-Gutierrez J, Baidoo E, Batth TS, Redding-Johanson AM, Petzold CJ, Mukhopadhyay A, Lee TS, Adams PD, Keasling JD. Nat Biotechnol. 2013 Nov;31(11):1039-46. doi: 10.1038/nbt.2689. Epub 2013 Oct 20. 10.1038/nbt.2689 PubMed 24142050