pCas2F
(Plasmid
#82377)
-
PurposedCas9 expressed from aTc-inducible promoter in acsA, F RBS: TGGGCG
-
Depositing Lab
-
Depositing OrganizationUniversity of Wisconsin, Madison
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 82377 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 82377-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 82377-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepACSA
- Total vector size (bp) 9154
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9
- Promoter PEZ3
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTTCCGGCTCGTATGTTGTG
- 3′ sequencing primer TTGGGTAACGCCAGGGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 82377-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 82377-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCas2F was a gift from Brian Pfleger (Addgene plasmid # 82377 ; http://n2t.net/addgene:82377 ; RRID:Addgene_82377) -
For your References section:
CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Gordon GC, Korosh TC, Cameron JC, Markley AL, Begemann MB, Pfleger BF. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007. 10.1016/j.ymben.2016.07.007 PubMed 27481676