pTRIPZ (M)-YFP-Eed
(Plasmid
#82512)
-
PurposeLentivirus vector. Expresses YFP-Eed fusion proteins in mammalian cells.
-
Depositing Lab
-
Depositing OrganizationUniversity of Colorado, Denver (Inactive)
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 82512 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepTRIPZ (M)
- Backbone size w/o insert (bp) 12906
- Total vector size (bp) 14906
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameembryonic ectoderm development
-
Alt nameEed
-
Mutationinsert contains AA39-441 of EeD
-
GenBank IDNM_021876
- Promoter cmv
-
Tag
/ Fusion Protein
- HaloTag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Ecor1 (unknown if destroyed)
- 3′ cloning site Mlu1 (unknown if destroyed)
- 5′ sequencing primer tggtcctgctggagttcgtgaccgc
- 3′ sequencing primer tcctcacggcgagcgctgccacgtc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRIPZ (M)-YFP-Eed was a gift from Xiaojun Ren (Addgene plasmid # 82512 ; http://n2t.net/addgene:82512 ; RRID:Addgene_82512)