-
PurposeExpresses sfCherry2(11) tagged H2B in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Francisco (UCSF)
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 82605 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 82605-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 82605-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-mEmerald-H2B
-
Backbone manufacturerMichael Davidson Fluorescent Protein Collection at the UCSF Nikon Imaging center
- Backbone size w/o insert (bp) 6500
- Total vector size (bp) 6500
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesfCherry2(11)_H2B
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1518
-
Mutationchanged Gly12 to Ala in sfCherry11+
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BmtI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CGCTAGCGCTACCGGTCGCC
- 3′ sequencing primer GTGGTATGGCTGATTATGATC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 82605-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 82605-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP_sfCherry2(11)_H2B was a gift from Bo Huang (Addgene plasmid # 82605 ; http://n2t.net/addgene:82605 ; RRID:Addgene_82605) -
For your References section:
Improved split fluorescent proteins for endogenous protein labeling. Feng S, Sekine S, Pessino V, Li H, Leonetti MD, Huang B. Nat Commun. 2017 Aug 29;8(1):370. doi: 10.1038/s41467-017-00494-8. 10.1038/s41467-017-00494-8 PubMed 28851864