Skip to main content

sgRNA 2 GAPDH
(Plasmid #83809)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83809 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 83809-D50 50 μg of DNA in Tris buffer $495
DNA 83809-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    MLM3636
  • Backbone size w/o insert (bp) 2278
  • Total vector size (bp) 2289
  • Modifications to backbone
    The oligos with overhang were synthesized, annealed and ligated into the sgRNA backbone linearized with BsmB1.
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SgRNA
  • gRNA/shRNA sequence
    AGCCCCAGCAAGAGCACAAG (AGG)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgRNA 2 GAPDH was a gift from Bo Feng (Addgene plasmid # 83809 ; http://n2t.net/addgene:83809 ; RRID:Addgene_83809)
  • For your References section:

    Knock-in of large reporter genes in human cells via CRISPR/Cas9-induced homology-dependent and independent DNA repair. He X, Tan C, Wang F, Wang Y, Zhou R, Cui D, You W, Zhao H, Ren J, Feng B. Nucleic Acids Res. 2016 May 19;44(9):e85. doi: 10.1093/nar/gkw064. Epub 2016 Feb 4. 10.1093/nar/gkw064 PubMed 26850641