Skip to main content
Addgene
Open Menu

pTH3
(Plasmid #84453)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84453 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 84453-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 84453-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pCM29
  • Backbone size w/o insert (bp) 6604
  • Total vector size (bp) 6580
  • Modifications to backbone
    sGFP replaced with insert
  • Vector type
    shuttle vector E.coli-S.aureus, expression of sGFP from the SarA-P1 promoter
  • Selectable markers
    also contains Chloramphenicol resistance gene, but only functional in Gram-postive bacteria.

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10F
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    YFP venus
  • Insert Size (bp)
    737

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site kpnI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TTGCATGCCTGCAGGTCGACTCTA
  • 3′ sequencing primer TTATGCTTCCGGCTCGTATGTTGTGTGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    YFP / Venus amplified from pJL77; Liese J, Rooijakkers SHM, van Strijp JAG, Novick RP, Dustin ML. 2013. Intravital two-photon microscopy of host–pathogen interactions in a mouse model of Staphylococcus aureus skin abscess formation. Cellular microbiology 15:891.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTH3 was a gift from Reindert Nijland (Addgene plasmid # 84453 ; http://n2t.net/addgene:84453 ; RRID:Addgene_84453)

  • For your References section:

    Fluorescent reporters for markerless genomic integration in Staphylococcus aureus. de Jong NW, van der Horst T, van Strijp JA, Nijland R. Sci Rep. 2017 Mar 7;7:43889. doi: 10.1038/srep43889. 10.1038/srep43889 PubMed 28266573
Related items:
Commonly requested with: