-
PurposeExpresses huLbCpf1-P2A-puro and crRNA guide
-
Depositing Lab
-
Depositing OrganizationBroad Institute
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84746 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 84746-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 84746-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5620
- Total vector size (bp) 10108
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namehuLbCpf1
-
Alt namehuLbCas12a
-
SpeciesSynthetic
-
Insert Size (bp)4392
- Promoter CMV
-
Tags
/ Fusion Proteins
- NLS (C terminal on insert)
- 3xHA (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepuromycin resistance gene
-
Alt namepuro
-
SpeciesSynthetic
-
Insert Size (bp)594
-
Tag
/ Fusion Protein
- T2A (N terminal on insert)
Resource Information
-
A portion of this plasmid was derived from a plasmid made by
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Modified pY027 plasmid with T2A-puro after huLbCpf1.
Contains a BsmBI cloning cassette for U6 driven crRNA expression.
DNA (Catalog # 84746-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 84746-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pY31 was a gift from Feng Zhang (Addgene plasmid # 84746 ; http://n2t.net/addgene:84746 ; RRID:Addgene_84746) -
For your References section:
Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Zetsche B, Heidenreich M, Mohanraju P, Fedorova I, Kneppers J, DeGennaro EM, Winblad N, Choudhury SR, Abudayyeh OO, Gootenberg JS, Wu WY, Scott DA, Severinov K, van der Oost J, Zhang F. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5. 10.1038/nbt.3737 PubMed 27918548