Skip to main content

pF713-pEGFP-N1-Hs-FL-METTL20 wt
(Plasmid #85114)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85114 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 85114-D50 50 μg of DNA in Tris buffer $495
DNA 85114-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFP-N1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human full-length METTL20
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    786
  • Entrez Gene
    METTL20 (a.k.a. C12orf72, MGC50559)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site SacII (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Homo sapiens wt METTL20, full-length, cloned into SacI-SacII sites of pEGFP-N1, in frame with EGFP, no STOP codon between METTL20 and EGFP

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pF713-pEGFP-N1-Hs-FL-METTL20 wt was a gift from Pal Falnes (Addgene plasmid # 85114 ; http://n2t.net/addgene:85114 ; RRID:Addgene_85114)
  • For your References section:

    Human METTL20 is a mitochondrial lysine methyltransferase that targets the beta subunit of electron transfer flavoprotein (ETFbeta) and modulates its activity. Malecki J, Ho AY, Moen A, Dahl HA, Falnes PO. J Biol Chem. 2015 Jan 2;290(1):423-34. doi: 10.1074/jbc.M114.614115. Epub 2014 Nov 21. 10.1074/jbc.M114.614115 PubMed 25416781