pF713-pEGFP-N1-Hs-FL-METTL20 wt
(Plasmid
#85114)
-
Purposetransfection of HeLa cell for transient expression of human full-length METTL20-EGFP fusion
-
Depositing Lab
-
Depositing OrganizationUniversity of Oslo
Located in Norway -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85114 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 85114-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 85114-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-N1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman full-length METTL20
-
SpeciesH. sapiens (human)
-
Insert Size (bp)786
-
Entrez GeneMETTL20 (a.k.a. C12orf72, MGC50559)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site SacII (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Homo sapiens wt METTL20, full-length, cloned into SacI-SacII sites of pEGFP-N1, in frame with EGFP, no STOP codon between METTL20 and EGFP
DNA (Catalog # 85114-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 85114-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pF713-pEGFP-N1-Hs-FL-METTL20 wt was a gift from Pal Falnes (Addgene plasmid # 85114 ; http://n2t.net/addgene:85114 ; RRID:Addgene_85114) -
For your References section:
Human METTL20 is a mitochondrial lysine methyltransferase that targets the beta subunit of electron transfer flavoprotein (ETFbeta) and modulates its activity. Malecki J, Ho AY, Moen A, Dahl HA, Falnes PO. J Biol Chem. 2015 Jan 2;290(1):423-34. doi: 10.1074/jbc.M114.614115. Epub 2014 Nov 21. 10.1074/jbc.M114.614115 PubMed 25416781