p-mCherry-N1-ChloC
(Plasmid #85461)

• Purpose: Historical plasmid. For inhibition of neuronal activity, #66709 is a light-gated chloride channel with improved anion selectivity (iChloC)
• Depositing Lab: Peter Hegemann
• Depositing Organization: Humboldt-Universitaet zu Berlin
  Located in Germany
• Publication: Wietek et al Science. 2014 Mar 27.

Backbone

• Vector backbone: pEGFP-N1
• Backbone size w/o insert (bp): 4733
• Total vector size (bp): 5660
• Modifications to backbone: EGFP has been replaced by inserting the complete fusion construct (ChR2-mCherry) using XbaI and BamHI cloning sites
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ChloC
• Alt name: Channelrhodopsin-2
• Alt name: Chr2
• Species: Synthetic; Chlamydomonas reinhardtii
• Insert Size (bp): 927
• Mutation: E90R, T159C
• GenBank ID: EU714030.1
• Promoter: CMV (+enhancer)
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (unknown if destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: EGFP-N1-F: GAGGTCTATATAAGCAGAGC or CMV-F: GCAAATGGGCGGTAGGCGT
• 3′ sequencing primer: EGFP-C1-R: AACCATTATAAGCTGCAATAAAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 85461-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 85461-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.