GST-RP2
(Plasmid
#86072)
-
PurposeA bacterial expression plasmid encoding retinitis pigmentosa 2 (RP2) with N-terminus GST-tag.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86072 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepGEX-4T1
-
Backbone manufacturerGE Healthcare
- Backbone size w/o insert (bp) 4969
- Total vector size (bp) 6015
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRP2
-
Alt nameretinitis pigmentosa 2
-
SpeciesH. sapiens (human)
-
Entrez GeneRP2 (a.k.a. DELXp11.3, NM23-H10, NME10, TBCCD2, XRP2)
- Promoter tac
-
Tag
/ Fusion Protein
- GST (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer 5' GGCAAGCCACGTTTGGTG 3'
- 3′ sequencing primer 5' GGAGCTGCATGTGTCAGAGG 3'
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe original RP2 gene was from addgene, clone pDONR223-RP2 (Plasmid #23636)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GST-RP2 was a gift from Lei Lu (Addgene plasmid # 86072 ; http://n2t.net/addgene:86072 ; RRID:Addgene_86072) -
For your References section:
A ternary complex comprising transportin1, Rab8 and the ciliary targeting signal directs proteins to ciliary membranes. Madugula V, Lu L. J Cell Sci. 2016 Oct 15;129(20):3922-3934. Epub 2016 Sep 15. 10.1242/jcs.194019 PubMed 27633000