Skip to main content
Addgene
Open Menu

pCMV-SPORT6-hHMGCR1
(Plasmid #86085)

Print

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86085 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 86085-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 86085-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pCMV-SPORT6-hHMGCR2
  • Backbone manufacturer
    I.M.A.G.E consortium (Library NIH_MGC_118, Image Id 5212903)
  • Backbone size w/o insert (bp) 5639
  • Total vector size (bp) 8305
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human HMG-CoA Reductase isoform 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2666
  • GenBank ID
    NM_000859.2
  • Entrez Gene
    HMGCR (a.k.a. LDLCQ3, LGMDR28, MYPLG)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstBI (not destroyed)
  • 3′ cloning site PvuII (not destroyed)
  • 5′ sequencing primer ccggactctagcctaggccg
  • 3′ sequencing primer tcctttagaacccaatgccc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    the I.M.A.G.E consortium (pCMV-SPORT6-hHMGCR2, Library NIH_MGC_118, Image Id 5212903),

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The pCMV-SPORT6-hHMGCR1 plasmid was obtained by inserting a fragment of human HMGCR1 in the pCMV-SPORT6-hHMGCR2 plasmid (Library NIH_MGC_118, Image Id 5212903) using BstBI and PvuII unique restriction sites.

Addgene note: This plasmid also contains a portion of the 3' UTR of HMCGR1.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-SPORT6-hHMGCR1 was a gift from Anne Galy (Addgene plasmid # 86085 ; http://n2t.net/addgene:86085 ; RRID:Addgene_86085)
Related items:
Commonly requested with: