Skip to main content

pHMGCS-Luc (aka: pES8)
(Plasmid #14947)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 14947 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 14947-D50 50 μg of DNA in Tris buffer $495
DNA 14947-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pGL2 basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5597
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HMG CoA synthase promoter
  • Alt name
    3-hydroxy-3-methylglutaryl CoA synthase
  • Alt name
    HMGCS
  • Species
    hamster
  • Insert Size (bp)
    400
  • GenBank ID
    AH001829
  • Tag / Fusion Protein
    • luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer n/a
  • 3′ sequencing primer LucNrev
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

To generate pHMGCS-Luc, a PCR fragment containing nucleotides –379 to –17 of the hamster 3-hydroxy-3-methylglutaryl (HMG) CoA synthase gene was cloned into pGL2-basic.

PCR'd using primers: CGATCTCCTCTCACTGACCTTC and GCAGCTTTATAGCCACCGACCC.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHMGCS-Luc (aka: pES8) was a gift from Axel Nohturfft (Addgene plasmid # 14947 ; http://n2t.net/addgene:14947 ; RRID:Addgene_14947)
  • For your References section:

    Transcriptional regulation of phagocytosis-induced membrane biogenesis by sterol regulatory element binding proteins. Castoreno AB, Wang Y, Stockinger W, Jarzylo LA, Du H, Pagnon JC, Shieh EC, Nohturfft A. Proc Natl Acad Sci U S A. 2005 Sep 13. 102(37):13129-34. 10.1073/pnas.0506716102 PubMed 16141315